Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121449 |
| Name | oriT_E7933|10  |
| Organism | Enterococcus faecium isolate E7933 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LR135393 (627..803 [+], 177 nt) |
| oriT length | 177 nt |
| IRs (inverted repeats) | 91..97, 107..113 (ATTTTTT..AAAAAAT) 92..98, 105..111 (TTTTTTG..CAAAAAA) 26..34, 37..45 (CACCTTCCT..AGGAAGGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 177 nt
>oriT_E7933|10
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGTGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21876 | GenBank | NZ_LR135393 |
| Plasmid name | E7933|10 | Incompatibility group | - |
| Plasmid size | 2056 bp | Coordinate of oriT [Strand] | 627..803 [+] |
| Host baterium | Enterococcus faecium isolate E7933 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |