Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121432 |
| Name | oriT_III  |
| Organism | Enterococcus faecium isolate EFE11651 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LN999989 (3356..3456 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_III
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
TCATCTGCCGAAACTTTGAATATGAGTGTGCCGACTTTCGTTAAGAAAAAGGCACAAGGCAGTCGATTGGTAGCGCCCAAATTAGATAAAGAGACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21859 | GenBank | NZ_LN999989 |
| Plasmid name | III | Incompatibility group | - |
| Plasmid size | 32402 bp | Coordinate of oriT [Strand] | 3356..3456 [+] |
| Host baterium | Enterococcus faecium isolate EFE11651 |
Cargo genes
| Drug resistance gene | cat(pC233), ant(6)-Ia, aph(3')-III, erm(B) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |