Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121431 |
| Name | oriT_PP1  |
| Organism | Pseudomonas syringae isolate CFBP3840 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LT963410 (14241..14422 [+], 182 nt) |
| oriT length | 182 nt |
| IRs (inverted repeats) | 81..89, 93..101 (CCAAAGGGG..CCCCTTTGG) 44..49, 58..63 (AAAAAG..CTTTTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 182 nt
>oriT_PP1
AAATCTCGAATTTGCTAAACAGGCACGTTACCGATTGTCTACAAAAAAGAGCTTCGCCTTTTTCGTAGCCAATCGACGTGCCAAAGGGGATACCCCTTTGGAACCCCGCAGAGCGGGAAAGCGTTGTCGTTGTCGTTGTTGGTTGTCGTCATTCAGGTGCCCCCAGGAGGTGATCTTGTGGC
AAATCTCGAATTTGCTAAACAGGCACGTTACCGATTGTCTACAAAAAAGAGCTTCGCCTTTTTCGTAGCCAATCGACGTGCCAAAGGGGATACCCCTTTGGAACCCCGCAGAGCGGGAAAGCGTTGTCGTTGTCGTTGTTGGTTGTCGTCATTCAGGTGCCCCCAGGAGGTGATCTTGTGGC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 99927..110164
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C6H39_RS29340 (CFBP3840_P100124) | 95964..96617 | + | 654 | WP_015060677 | division plane positioning ATPase MipZ | - |
| C6H39_RS29345 | 96666..96977 | + | 312 | WP_053480882 | hypothetical protein | - |
| C6H39_RS29355 | 97296..97676 | - | 381 | WP_015060680 | hypothetical protein | - |
| C6H39_RS29360 (CFBP3840_P100126) | 97919..98389 | - | 471 | WP_053480883 | DUF6392 family protein | - |
| C6H39_RS29365 | 98477..98827 | - | 351 | WP_015060682 | helix-turn-helix domain-containing protein | - |
| C6H39_RS29370 (CFBP3840_P100127) | 99091..99618 | + | 528 | WP_104721053 | transcription termination/antitermination NusG family protein | - |
| C6H39_RS29375 | 99683..99898 | + | 216 | WP_004666691 | hypothetical protein | - |
| C6H39_RS29380 (CFBP3840_P100128) | 99927..100634 | + | 708 | WP_104721054 | lytic transglycosylase domain-containing protein | virB1 |
| C6H39_RS29385 (CFBP3840_P100129) | 100634..100969 | + | 336 | WP_104721062 | conjugal transfer protein | - |
| C6H39_RS29390 | 100982..101470 | + | 489 | WP_104721055 | VirB3 family type IV secretion system protein | virB3 |
| C6H39_RS29395 (CFBP3840_P100130) | 101373..103871 | + | 2499 | WP_231994969 | conjugal transfer protein | virb4 |
| C6H39_RS29400 (CFBP3840_P100131) | 103868..104548 | + | 681 | WP_104721057 | P-type DNA transfer protein VirB5 | - |
| C6H39_RS29405 (CFBP3840_P100132) | 104563..104769 | + | 207 | WP_031598978 | hypothetical protein | - |
| C6H39_RS29410 (CFBP3840_P100133) | 104796..105740 | + | 945 | WP_031598977 | type IV secretion system protein | virB6 |
| C6H39_RS29420 (CFBP3840_P100134) | 106149..106937 | + | 789 | WP_060404299 | virB8 family protein | virB8 |
| C6H39_RS29425 (CFBP3840_P100135) | 106927..107736 | + | 810 | WP_060407406 | P-type conjugative transfer protein VirB9 | virB9 |
| C6H39_RS29430 (CFBP3840_P100136) | 107723..109096 | + | 1374 | WP_104721048 | TrbI/VirB10 family protein | virB10 |
| C6H39_RS29435 (CFBP3840_P100137) | 109106..110164 | + | 1059 | WP_104721058 | P-type DNA transfer ATPase VirB11 | virB11 |
Host bacterium
| ID | 21858 | GenBank | NZ_LT963410 |
| Plasmid name | PP1 | Incompatibility group | - |
| Plasmid size | 110420 bp | Coordinate of oriT [Strand] | 14241..14422 [+] |
| Host baterium | Pseudomonas syringae isolate CFBP3840 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |