Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 121383 |
Name | oriT_MFPB19|4 |
Organism | Latilactobacillus sakei isolate MFPB19 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LT960787 (10649..10686 [+], 38 nt) |
oriT length | 38 nt |
IRs (inverted repeats) | 1..6, 20..25 (ACACCA..TGGTGT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_MFPB19|4
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
ACACCAGCAATTTTAATTGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 21810 | GenBank | NZ_LT960787 |
Plasmid name | MFPB19|4 | Incompatibility group | - |
Plasmid size | 11156 bp | Coordinate of oriT [Strand] | 10649..10686 [+] |
Host baterium | Latilactobacillus sakei isolate MFPB19 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |