Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121243 |
| Name | oriT_pNUITM-VA1_1  |
| Organism | Aeromonas hydrophila strain NUITM-VA1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP025278 (4669..4829 [-], 161 nt) |
| oriT length | 161 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCGTAC..GTACGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 161 nt
>oriT_pNUITM-VA1_1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCGTACAAAGTACGGTCGGGGTTTGCCGCCGTCGTGCCTCCATGATAGCCTAAGAGACAGCACATTAACAATGAGGTGTCAAGATGGCTAAGGGGAGCAACAAGGCGGCGGATAGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCGTACAAAGTACGGTCGGGGTTTGCCGCCGTCGTGCCTCCATGATAGCCTAAGAGACAGCACATTAACAATGAGGTGTCAAGATGGCTAAGGGGAGCAACAAGGCGGCGGATAGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21671 | GenBank | NZ_AP025278 |
| Plasmid name | pNUITM-VA1_1 | Incompatibility group | IncQ1 |
| Plasmid size | 8138 bp | Coordinate of oriT [Strand] | 4669..4829 [-] |
| Host baterium | Aeromonas hydrophila strain NUITM-VA1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |