Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121243
Name   oriT_pNUITM-VA1_1 in_silico
Organism   Aeromonas hydrophila strain NUITM-VA1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP025278 (4669..4829 [-], 161 nt)
oriT length   161 nt
IRs (inverted repeats)      39..44, 48..53  (CCGTAC..GTACGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 161 nt

>oriT_pNUITM-VA1_1
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCGTACAAAGTACGGTCGGGGTTTGCCGCCGTCGTGCCTCCATGATAGCCTAAGAGACAGCACATTAACAATGAGGTGTCAAGATGGCTAAGGGGAGCAACAAGGCGGCGGATAGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21671 GenBank   NZ_AP025278
Plasmid name   pNUITM-VA1_1 Incompatibility group   IncQ1
Plasmid size   8138 bp Coordinate of oriT [Strand]   4669..4829 [-]
Host baterium   Aeromonas hydrophila strain NUITM-VA1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -