Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121235
Name   oriT_pEc61C in_silico
Organism   Enterobacter hormaechei subsp. xiangfangensis strain Ec61
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP053106 (5505..5664 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pEc61C
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21663 GenBank   NZ_CP053106
Plasmid name   pEc61C Incompatibility group   IncQ1
Plasmid size   8382 bp Coordinate of oriT [Strand]   5505..5664 [-]
Host baterium   Enterobacter hormaechei subsp. xiangfangensis strain Ec61

Cargo genes


Drug resistance gene   aph(3')-VIa, blaBKC-1
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -