Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121233 |
| Name | oriT_FDAARGOS_719|unnamed1  |
| Organism | Burkholderia multivorans strain FDAARGOS_719 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP046339 (566..622 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_FDAARGOS_719|unnamed1
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21661 | GenBank | NZ_CP046339 |
| Plasmid name | FDAARGOS_719|unnamed1 | Incompatibility group | ColRNAI |
| Plasmid size | 2579 bp | Coordinate of oriT [Strand] | 566..622 [-] |
| Host baterium | Burkholderia multivorans strain FDAARGOS_719 |
Cargo genes
| Drug resistance gene | qnrB19 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |