Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121209
Name   oriT_pSCBC2-9 in_silico
Organism   Proteus mirabilis strain SCBC2-9
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MK988618 (4489..4648 [+], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pSCBC2-9
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21637 GenBank   NZ_MK988618
Plasmid name   pSCBC2-9 Incompatibility group   IncQ1
Plasmid size   6659 bp Coordinate of oriT [Strand]   4489..4648 [+]
Host baterium   Proteus mirabilis strain SCBC2-9

Cargo genes


Drug resistance gene   blaCMY-4
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -