Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121203 |
| Name | oriT_p34978-5.413kb  |
| Organism | Enterobacter hormaechei subsp. xiangfangensis strain 34978 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP010367 (1528..1587 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_p34978-5.413kb
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21631 | GenBank | NZ_CP010367 |
| Plasmid name | p34978-5.413kb | Incompatibility group | Col440II |
| Plasmid size | 5413 bp | Coordinate of oriT [Strand] | 1528..1587 [+] |
| Host baterium | Enterobacter hormaechei subsp. xiangfangensis strain 34978 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |