Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121166 |
| Name | oriT_ceto|p3  |
| Organism | Cetobacterium somerae strain ceto |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP143322 (180674..180853 [+], 180 nt) |
| oriT length | 180 nt |
| IRs (inverted repeats) | 18..23, 30..35 (AGGAAA..TTTCCT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 180 nt
>oriT_ceto|p3
GGGTAAAGGAAGAATTGAGGAAATAGAGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACATTTCATATCGAAATTCCAAATGAGTATAGATAACTGCAAATAACAGTTTGTAGGGG
GGGTAAAGGAAGAATTGAGGAAATAGAGGTTTCCTGTATTGAACCATATAGTCAAGTAATGTTCCATCTGGGATACGAGTTTGATGAAAATGATGCACATGATGTGAAGTTATTGTGTGAGACATTTCATATCGAAATTCCAAATGAGTATAGATAACTGCAAATAACAGTTTGTAGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21594 | GenBank | NZ_CP143322 |
| Plasmid name | ceto|p3 | Incompatibility group | - |
| Plasmid size | 188661 bp | Coordinate of oriT [Strand] | 180674..180853 [+] |
| Host baterium | Cetobacterium somerae strain ceto |
Cargo genes
| Drug resistance gene | lnu(C) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA7, AcrIIA1 |