Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121148 |
| Name | oriT_pCAV1043-10  |
| Organism | Enterobacter asburiae strain CAV1043 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP011586 (907..963 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pCAV1043-10
GGGTTCTGGGCGCAGCCCTGAACCAGTCGAGTAGCACTAGCTGAGTGTATACGGGCT
GGGTTCTGGGCGCAGCCCTGAACCAGTCGAGTAGCACTAGCTGAGTGTATACGGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21576 | GenBank | NZ_CP011586 |
| Plasmid name | pCAV1043-10 | Incompatibility group | Col440I |
| Plasmid size | 10403 bp | Coordinate of oriT [Strand] | 907..963 [+] |
| Host baterium | Enterobacter asburiae strain CAV1043 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |