Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121123
Name   oriT_pF1917-9 in_silico
Organism   Citrobacter freundii strain F1917
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP137190 (2067..2126 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pF1917-9
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21551 GenBank   NZ_CP137190
Plasmid name   pF1917-9 Incompatibility group   -
Plasmid size   3428 bp Coordinate of oriT [Strand]   2067..2126 [-]
Host baterium   Citrobacter freundii strain F1917

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -