Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   121075
Name   oriT_pB18196_4 in_silico
Organism   Citrobacter freundii strain B18196
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP142908 (9866..9925 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pB18196_4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21503 GenBank   NZ_CP142908
Plasmid name   pB18196_4 Incompatibility group   Col440I
Plasmid size   11096 bp Coordinate of oriT [Strand]   9866..9925 [-]
Host baterium   Citrobacter freundii strain B18196

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -