Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121014 |
| Name | oriT_pPCP1  |
| Organism | Yersinia pestis subsp. microtus bv. Talassica strain SCPM-O-B-7019 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LIYW01000199 (1256..1315 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pPCP1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21443 | GenBank | NZ_LIYW01000199 |
| Plasmid name | pPCP1 | Incompatibility group | - |
| Plasmid size | 1755 bp | Coordinate of oriT [Strand] | 1256..1315 [+] |
| Host baterium | Yersinia pestis subsp. microtus bv. Talassica strain SCPM-O-B-7019 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |