Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121013 |
| Name | oriT_pSTN0717-36-3  |
| Organism | Citrobacter portucalensis strain STN0717-36 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022497 (20748..20796 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..11, 18..23 (GCAAAA..TTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pSTN0717-36-3
AATCAGCAAAACTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCAGCAAAACTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21442 | GenBank | NZ_AP022497 |
| Plasmid name | pSTN0717-36-3 | Incompatibility group | IncFIA |
| Plasmid size | 61728 bp | Coordinate of oriT [Strand] | 20748..20796 [-] |
| Host baterium | Citrobacter portucalensis strain STN0717-36 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |