Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 121006 |
| Name | oriT_pKAM339_6  |
| Organism | Aeromonas caviae strain KAM339 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP024946 (4883..4918 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 3..9, 13..19 (GTTTCTC..GAGAAAC) |
| Location of nic site | 30..31 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pKAM339_6
CAGTTTCTCGCAGAGAAACCGGTAAGTGCGCCCTCC
CAGTTTCTCGCAGAGAAACCGGTAAGTGCGCCCTCC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21435 | GenBank | NZ_AP024946 |
| Plasmid name | pKAM339_6 | Incompatibility group | IncQ1 |
| Plasmid size | 4998 bp | Coordinate of oriT [Strand] | 4883..4918 [+] |
| Host baterium | Aeromonas caviae strain KAM339 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |