Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120992
Name   oriT_HQ-51-Ba|punnamed1 in_silico
Organism   Bacillus altitudinis strain HQ-51-Ba
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP040746 (3009..3032 [+], 24 nt)
oriT length   24 nt
IRs (inverted repeats)      1..7, 18..24  (ACCCCCC..GGGGGGT)
 3..8, 18..23  (CCCCCC..GGGGGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 24 nt

>oriT_HQ-51-Ba|punnamed1
ACCCCCCCACTCTAACAGGGGGGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21421 GenBank   NZ_CP040746
Plasmid name   HQ-51-Ba|punnamed1 Incompatibility group   -
Plasmid size   7089 bp Coordinate of oriT [Strand]   3009..3032 [+]
Host baterium   Bacillus altitudinis strain HQ-51-Ba

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -