Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120992 |
| Name | oriT_HQ-51-Ba|punnamed1  |
| Organism | Bacillus altitudinis strain HQ-51-Ba |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP040746 (3009..3032 [+], 24 nt) |
| oriT length | 24 nt |
| IRs (inverted repeats) | 1..7, 18..24 (ACCCCCC..GGGGGGT) 3..8, 18..23 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 24 nt
>oriT_HQ-51-Ba|punnamed1
ACCCCCCCACTCTAACAGGGGGGT
ACCCCCCCACTCTAACAGGGGGGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21421 | GenBank | NZ_CP040746 |
| Plasmid name | HQ-51-Ba|punnamed1 | Incompatibility group | - |
| Plasmid size | 7089 bp | Coordinate of oriT [Strand] | 3009..3032 [+] |
| Host baterium | Bacillus altitudinis strain HQ-51-Ba |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |