Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120991
Name   oriT_p4_tig6 in_silico
Organism   Pseudomonas amygdali pv. morsprunorum strain R15244
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP026561 (1301..1515 [+], 215 nt)
oriT length   215 nt
IRs (inverted repeats)      115..122, 126..133  (CAAAGGGG..CCCCTTTG)
 77..82, 91..96  (AAAAAG..CTTTTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 215 nt

>oriT_p4_tig6
TGCAGTGTGCACTTGTCTTCTGGAGCCGTACTCGAAATCCGAATTCGCAAAACAGGCACGTTACCGATTGTCTACAAAAAAGAGCTTCGCCTTTTTCGTAGCCAATCGACGTGCCAAAGGGGATACCCCTTTGAAACCCCGCAGAGCGGGAAAGCGTTGTCGTTGTCGTTGTTGGTTGTCGTCATTCAGGTGCCCTCAGGAGGTGATCTTGTGGC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21420 GenBank   NZ_CP026561
Plasmid name   p4_tig6 Incompatibility group   -
Plasmid size   40810 bp Coordinate of oriT [Strand]   1301..1515 [+]
Host baterium   Pseudomonas amygdali pv. morsprunorum strain R15244

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -