Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120960
Name   oriT_pCAV1761-3223 in_silico
Organism   Serratia marcescens strain CAV1761
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP029444 (2147..2204 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pCAV1761-3223
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21389 GenBank   NZ_CP029444
Plasmid name   pCAV1761-3223 Incompatibility group   Col440II
Plasmid size   3223 bp Coordinate of oriT [Strand]   2147..2204 [+]
Host baterium   Serratia marcescens strain CAV1761

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -