Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120958 |
Name | oriT_pPCP1 |
Organism | Yersinia pestis subsp. microtus bv. Hissarica strain SCPM-O-B-6304 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LIYS01000119 (1255..1314 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pPCP1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 21387 | GenBank | NZ_LIYS01000119 |
Plasmid name | pPCP1 | Incompatibility group | ColRNAI |
Plasmid size | 7664 bp | Coordinate of oriT [Strand] | 1255..1314 [+] |
Host baterium | Yersinia pestis subsp. microtus bv. Hissarica strain SCPM-O-B-6304 |
Cargo genes
Drug resistance gene | - |
Virulence gene | pla |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |