Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120946 |
| Name | oriT_Cap 100.1|unnamed1  |
| Organism | Staphylococcus warneri strain Cap 100.1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP049803 (1875..1972 [-], 98 nt) |
| oriT length | 98 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 66..67 |
| Conserved sequence flanking the nic site |
GATTGGTCGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 98 nt
>oriT_Cap 100.1|unnamed1
TCTGCCGATACTTTAAATATGAGTGTGCCTAATTTCGTTAAGAAAAAGGCACAGGGTAGTCGATTGGTCGCACCTAAATTTGATAAAGAAACGCGACA
TCTGCCGATACTTTAAATATGAGTGTGCCTAATTTCGTTAAGAAAAAGGCACAGGGTAGTCGATTGGTCGCACCTAAATTTGATAAAGAAACGCGACA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21375 | GenBank | NZ_CP049803 |
| Plasmid name | Cap 100.1|unnamed1 | Incompatibility group | - |
| Plasmid size | 4251 bp | Coordinate of oriT [Strand] | 1875..1972 [-] |
| Host baterium | Staphylococcus warneri strain Cap 100.1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |