Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120933 |
| Name | oriT_pEPSC8  |
| Organism | Lactococcus cremoris strain EPSC |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP024230 (1889..2025 [+], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 21..28, 42..49 (AAAAGGGG..CCCCTTTT) 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_pEPSC8
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATGGTCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21362 | GenBank | NZ_AP024230 |
| Plasmid name | pEPSC8 | Incompatibility group | - |
| Plasmid size | 5653 bp | Coordinate of oriT [Strand] | 1889..2025 [+] |
| Host baterium | Lactococcus cremoris strain EPSC |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |