Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120909 |
| Name | oriT_pHRB800  |
| Organism | Sinorhizobium meliloti strain USDA1963 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP011000 (182981..183017 [+], 37 nt) |
| oriT length | 37 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 37 nt
>oriT_pHRB800
GGATCCAAGGGCGCAATTATACGTCGCTGGCGCTACG
GGATCCAAGGGCGCAATTATACGTCGCTGGCGCTACG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21338 | GenBank | NZ_CP011000 |
| Plasmid name | pHRB800 | Incompatibility group | - |
| Plasmid size | 198992 bp | Coordinate of oriT [Strand] | 182981..183017 [+] |
| Host baterium | Sinorhizobium meliloti strain USDA1963 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | htpB |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |