Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120831 |
| Name | oriT_pB-8086-3  |
| Organism | Yersinia aleksiciae strain SCPM-O-B-8086 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP139922 (2787..2846 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pB-8086-3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21260 | GenBank | NZ_CP139922 |
| Plasmid name | pB-8086-3 | Incompatibility group | ColRNAI |
| Plasmid size | 4666 bp | Coordinate of oriT [Strand] | 2787..2846 [-] |
| Host baterium | Yersinia aleksiciae strain SCPM-O-B-8086 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |