Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120808
Name   oriT_SIO|unnamed in_silico
Organism   Vibrio paracholerae strain SIO
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP137090 (131567..131848 [-], 282 nt)
oriT length   282 nt
IRs (inverted repeats)      236..241, 253..258  (GCCAAA..TTTGGC)
 76..81, 92..97  (ATCAAA..TTTGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 282 nt

>oriT_SIO|unnamed
GCGCTGTTTGGCGGCATTTGGCTAGTGCAAAAAAATCGAGACGCCAAACGATCGTTTGCATTCTGGGTTGGAAAAATCAAACGGTTTGTACTTTGATGCCGAGGTTGGTTTAGGGTGAAAAAAGTGCCAAATCTTTCTTTAAGCCAGTATTGGCAAGGCCTAGCAGCGTTGGATTTCAATCGAGAAGCCAAACAGTAAATGGGTTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAGTGGTTTTGGCGTATGGGGGTAAAGCCATGGGGAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21237 GenBank   NZ_CP137090
Plasmid name   SIO|unnamed Incompatibility group   -
Plasmid size   278143 bp Coordinate of oriT [Strand]   131567..131848 [-]
Host baterium   Vibrio paracholerae strain SIO

Cargo genes


Drug resistance gene   -
Virulence gene   wbtL, rfaD, lgtF, tufA
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA7