Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120806 |
Name | oriT_pJIR2774 |
Organism | Clostridium perfringens 95-949 pJIR2774 lnu(P) |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NG_047929 (440..643 [+], 204 nt) |
oriT length | 204 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 204 nt
>oriT_pJIR2774
GGTGTTGGAAAAATAGGAAATATTATGGTTTCTTGTATAAATGCTAAAAATCAAGTCTTATTTCACTTAGGGTATGAATTTGGAGAAAGTGATATTCATGATGTAAAATTATTATGTAAAGAATTTAACATTCCGATACCTAAAGAATATGAAAATTTTTAAATTAGCGATAATTATAATCTTTAGATTTAATAATATTACTAT
GGTGTTGGAAAAATAGGAAATATTATGGTTTCTTGTATAAATGCTAAAAATCAAGTCTTATTTCACTTAGGGTATGAATTTGGAGAAAGTGATATTCATGATGTAAAATTATTATGTAAAGAATTTAACATTCCGATACCTAAAGAATATGAAAATTTTTAAATTAGCGATAATTATAATCTTTAGATTTAATAATATTACTAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 21235 | GenBank | NG_047929 |
Plasmid name | pJIR2774 | Incompatibility group | - |
Plasmid size | 701 bp | Coordinate of oriT [Strand] | 440..643 [+] |
Host baterium | Clostridium perfringens 95-949 pJIR2774 lnu(P) |
Cargo genes
Drug resistance gene | lnu(P) |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |