Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120806
Name   oriT_pJIR2774 in_silico
Organism   Clostridium perfringens 95-949 pJIR2774 lnu(P)
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NG_047929 (440..643 [+], 204 nt)
oriT length   204 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 204 nt

>oriT_pJIR2774
GGTGTTGGAAAAATAGGAAATATTATGGTTTCTTGTATAAATGCTAAAAATCAAGTCTTATTTCACTTAGGGTATGAATTTGGAGAAAGTGATATTCATGATGTAAAATTATTATGTAAAGAATTTAACATTCCGATACCTAAAGAATATGAAAATTTTTAAATTAGCGATAATTATAATCTTTAGATTTAATAATATTACTAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21235 GenBank   NG_047929
Plasmid name   pJIR2774 Incompatibility group   -
Plasmid size   701 bp Coordinate of oriT [Strand]   440..643 [+]
Host baterium   Clostridium perfringens 95-949 pJIR2774 lnu(P)

Cargo genes


Drug resistance gene   lnu(P)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -