Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120785
Name   oriT_pMB5632_5 in_silico
Organism   Klebsiella aerogenes strain 4417
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP103669 (5813..5872 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pMB5632_5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21214 GenBank   NZ_CP103669
Plasmid name   pMB5632_5 Incompatibility group   ColRNAI
Plasmid size   6282 bp Coordinate of oriT [Strand]   5813..5872 [-]
Host baterium   Klebsiella aerogenes strain 4417

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -