Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120782
Name   oriT_pE61_004 in_silico
Organism   Leclercia adecarboxylata strain E61
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP042497 (8254..8312 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pE61_004
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21211 GenBank   NZ_CP042497
Plasmid name   pE61_004 Incompatibility group   Col440II
Plasmid size   8836 bp Coordinate of oriT [Strand]   8254..8312 [-]
Host baterium   Leclercia adecarboxylata strain E61

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -