Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120780 |
| Name | oriT_pE1_005  |
| Organism | Leclercia adecarboxylata strain E1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP042510 (4022..4079 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pE1_005
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21209 | GenBank | NZ_CP042510 |
| Plasmid name | pE1_005 | Incompatibility group | ColRNAI |
| Plasmid size | 4678 bp | Coordinate of oriT [Strand] | 4022..4079 [-] |
| Host baterium | Leclercia adecarboxylata strain E1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |