Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120736
Name   oriT_pRHBSTW-00464_7 in_silico
Organism   Klebsiella sp. RHBSTW-00464
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056489 (1247..1306 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00464_7
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21165 GenBank   NZ_CP056489
Plasmid name   pRHBSTW-00464_7 Incompatibility group   Col440II
Plasmid size   4678 bp Coordinate of oriT [Strand]   1247..1306 [+]
Host baterium   Klebsiella sp. RHBSTW-00464

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -