Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120735 |
Name | oriT_pRHBSTW-00464_6 |
Organism | Klebsiella sp. RHBSTW-00464 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP056488 (4213..4271 [+], 59 nt) |
oriT length | 59 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pRHBSTW-00464_6
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 21164 | GenBank | NZ_CP056488 |
Plasmid name | pRHBSTW-00464_6 | Incompatibility group | Col440II |
Plasmid size | 6785 bp | Coordinate of oriT [Strand] | 4213..4271 [+] |
Host baterium | Klebsiella sp. RHBSTW-00464 |
Cargo genes
Drug resistance gene | - |
Virulence gene | katA |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |