Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120732 |
| Name | oriT_pKqq_U41_13  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084802 (1610..1661 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 6..14, 17..25 (CGCAAAATT..AATTTTGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pKqq_U41_13
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGATATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21161 | GenBank | NZ_CP084802 |
| Plasmid name | pKqq_U41_13 | Incompatibility group | ColRNAI |
| Plasmid size | 3335 bp | Coordinate of oriT [Strand] | 1610..1661 [-] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |