Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120731 |
| Name | oriT_pKqq_U41_11  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084800 (3516..3575 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pKqq_U41_11
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21160 | GenBank | NZ_CP084800 |
| Plasmid name | pKqq_U41_11 | Incompatibility group | ColRNAI |
| Plasmid size | 3708 bp | Coordinate of oriT [Strand] | 3516..3575 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |