Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120730 |
| Name | oriT_pKqq_U41_7  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP084796 (3165..3219 [+], 55 nt) |
| oriT length | 55 nt |
| IRs (inverted repeats) | 1..7, 11..17 (TCAGGGC..GCCCTGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 55 nt
>oriT_pKqq_U41_7
TCAGGGCGCAGCCCTGAACCAGTCACGTAGCACTAGCGGAGTGTATACTGGCTTA
TCAGGGCGCAGCCCTGAACCAGTCACGTAGCACTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21159 | GenBank | NZ_CP084796 |
| Plasmid name | pKqq_U41_7 | Incompatibility group | ColRNAI |
| Plasmid size | 5752 bp | Coordinate of oriT [Strand] | 3165..3219 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain U41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |