Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120720 |
| Name | oriT_KPN710429|unnamed1  |
| Organism | Klebsiella quasipneumoniae strain KPN710429 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP073657 (136608..136657 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN710429|unnamed1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21149 | GenBank | NZ_CP073657 |
| Plasmid name | KPN710429|unnamed1 | Incompatibility group | IncFIB |
| Plasmid size | 170592 bp | Coordinate of oriT [Strand] | 136608..136657 [-] |
| Host baterium | Klebsiella quasipneumoniae strain KPN710429 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | fecE, fecD, arsR, arsD, arsA, arsB, arsC, arsH, pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, nirA |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |