Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120609
Name   oriT_18|P5 in_silico
Organism   Citrobacter freundii isolate 18
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OW849261 (723..782 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_18|P5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21038 GenBank   NZ_OW849261
Plasmid name   18|P5 Incompatibility group   -
Plasmid size   1335 bp Coordinate of oriT [Strand]   723..782 [+]
Host baterium   Citrobacter freundii isolate 18

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -