Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120604
Name   oriT_pCF20-4P-1-4 in_silico
Organism   Citrobacter freundii strain CF20-4P-1 isolate gut contents of Mastacembelus
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP026944 (763..822 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pCF20-4P-1-4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21033 GenBank   NZ_AP026944
Plasmid name   pCF20-4P-1-4 Incompatibility group   ColRNAI
Plasmid size   4858 bp Coordinate of oriT [Strand]   763..822 [-]
Host baterium   Citrobacter freundii strain CF20-4P-1 isolate gut contents of Mastacembelus

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -