Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120600 |
| Name | oriT_22|P7  |
| Organism | Citrobacter freundii isolate 22 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OW969882 (341..399 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_22|P7
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21029 | GenBank | NZ_OW969882 |
| Plasmid name | 22|P7 | Incompatibility group | Col440I |
| Plasmid size | 2317 bp | Coordinate of oriT [Strand] | 341..399 [+] |
| Host baterium | Citrobacter freundii isolate 22 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |