Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120581
Name   oriT_pUKJ86_2 in_silico
Organism   Citrobacter freundii strain UKJ86
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP139851 (1849..1906 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pUKJ86_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   21010 GenBank   NZ_CP139851
Plasmid name   pUKJ86_2 Incompatibility group   Col440II
Plasmid size   3198 bp Coordinate of oriT [Strand]   1849..1906 [+]
Host baterium   Citrobacter freundii strain UKJ86

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -