Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120580 |
| Name | oriT_CF2|unnamed1 |
| Organism | Citrobacter freundii strain CF2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP133851 (8532..8632 [+], 101 nt) |
| oriT length | 101 nt |
| IRs (inverted repeats) | 80..85, 91..96 (AAAAAA..TTTTTT) 20..26, 38..44 (TAAATCA..TGATTTA) |
| Location of nic site | 62..63 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 101 nt
>oriT_CF2|unnamed1
TATTTATTTTTTTATCTTTTAAATCATTATGATAGCGTGATTTATCGCGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TATTTATTTTTTTATCTTTTAAATCATTATGATAGCGTGATTTATCGCGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 21009 | GenBank | NZ_CP133851 |
| Plasmid name | CF2|unnamed1 | Incompatibility group | IncN |
| Plasmid size | 30566 bp | Coordinate of oriT [Strand] | 8532..8632 [+] |
| Host baterium | Citrobacter freundii strain CF2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |