Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120552
Name   oriT_pKOX100_2 in_silico
Organism   Klebsiella oxytoca strain Kox100
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP089413 (44855..44953 [+], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_pKOX100_2
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20981 GenBank   NZ_CP089413
Plasmid name   pKOX100_2 Incompatibility group   IncR
Plasmid size   76438 bp Coordinate of oriT [Strand]   44855..44953 [+]
Host baterium   Klebsiella oxytoca strain Kox100

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, merR, merT, merP, merC, merA, merD, arsR, arsD, arsA, arsB, arsC, silS, silR, silC, silF, silB, silA, silP
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -