Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120549 |
| Name | oriT_pRHBSTW-00555_6  |
| Organism | Klebsiella grimontii strain RHBSTW-00555 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055320 (2117..2167 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pRHBSTW-00555_6
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20978 | GenBank | NZ_CP055320 |
| Plasmid name | pRHBSTW-00555_6 | Incompatibility group | Col440I |
| Plasmid size | 5783 bp | Coordinate of oriT [Strand] | 2117..2167 [+] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00555 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |