Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120541 |
| Name | oriT_AR375|unnamed3  |
| Organism | Klebsiella michiganensis strain AR375 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029143 (132088..132137 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_AR375|unnamed3
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20970 | GenBank | NZ_CP029143 |
| Plasmid name | AR375|unnamed3 | Incompatibility group | IncFII |
| Plasmid size | 134879 bp | Coordinate of oriT [Strand] | 132088..132137 [-] |
| Host baterium | Klebsiella michiganensis strain AR375 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsC, arsB, arsR, arsD, arsA, pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE, merR, merT, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |