Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120483
Name   oriT_pRHBSTW-00084_5 in_silico
Organism   Citrobacter freundii strain RHBSTW-00084
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055592 (6495..6554 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00084_5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20912 GenBank   NZ_CP055592
Plasmid name   pRHBSTW-00084_5 Incompatibility group   Col440I
Plasmid size   7536 bp Coordinate of oriT [Strand]   6495..6554 [-]
Host baterium   Citrobacter freundii strain RHBSTW-00084

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -