Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120478 |
Name | oriT_pE11_005 |
Organism | Citrobacter freundii strain E11 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP042529 (2425..2482 [+], 58 nt) |
oriT length | 58 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pE11_005
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 20907 | GenBank | NZ_CP042529 |
Plasmid name | pE11_005 | Incompatibility group | Col440II |
Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 2425..2482 [+] |
Host baterium | Citrobacter freundii strain E11 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |