Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 120464 |
Name | oriT_pR47-54 |
Organism | Citrobacter freundii strain R47 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP040697 (34212..34306 [-], 95 nt) |
oriT length | 95 nt |
IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
Location of nic site | 55..56 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pR47-54
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 20893 | GenBank | NZ_CP040697 |
Plasmid name | pR47-54 | Incompatibility group | IncR |
Plasmid size | 53964 bp | Coordinate of oriT [Strand] | 34212..34306 [-] |
Host baterium | Citrobacter freundii strain R47 |
Cargo genes
Drug resistance gene | floR, sul1, qacE, qnrB6, aadA16, dfrA27, ARR-3, aac(6')-Ib-cr |
Virulence gene | - |
Metal resistance gene | merE, merD, merA, merC, merP, merT, merR |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |