Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120424 |
| Name | oriT_p31C17001_B_KPC  |
| Organism | Citrobacter freundii strain 31C17CRGN001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OQ821199 (5176..5233 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p31C17001_B_KPC
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20853 | GenBank | NZ_OQ821199 |
| Plasmid name | p31C17001_B_KPC | Incompatibility group | Col440II |
| Plasmid size | 13234 bp | Coordinate of oriT [Strand] | 5176..5233 [+] |
| Host baterium | Citrobacter freundii strain 31C17CRGN001 |
Cargo genes
| Drug resistance gene | blaKPC-3 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |