Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120418
Name   oriT_p21C19007C_A_KPC in_silico
Organism   Citrobacter freundii strain 21C19CPO007C
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OQ821113 (7073..7132 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p21C19007C_A_KPC
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20847 GenBank   NZ_OQ821113
Plasmid name   p21C19007C_A_KPC Incompatibility group   Col440II
Plasmid size   14437 bp Coordinate of oriT [Strand]   7073..7132 [+]
Host baterium   Citrobacter freundii strain 21C19CPO007C

Cargo genes


Drug resistance gene   blaKPC-3
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -