Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 120403 |
| Name | oriT_p11A1213027_C_KPC  |
| Organism | Citrobacter freundii strain 11A1213CRGN027 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OQ821053 (8425..8482 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_p11A1213027_C_KPC
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 20832 | GenBank | NZ_OQ821053 |
| Plasmid name | p11A1213027_C_KPC | Incompatibility group | ColRNAI |
| Plasmid size | 15908 bp | Coordinate of oriT [Strand] | 8425..8482 [+] |
| Host baterium | Citrobacter freundii strain 11A1213CRGN027 |
Cargo genes
| Drug resistance gene | blaKPC-3 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |