Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   120393
Name   oriT_p11A1213097B_A_KPC in_silico
Organism   Enterobacter cloacae subsp. cloacae strain 11A1213CRGN097B
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OQ821059 (34400..34494 [+], 95 nt)
oriT length   95 nt
IRs (inverted repeats)      73..78, 85..90  (AAAAAA..TTTTTT)
 73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 95 nt

>oriT_p11A1213097B_A_KPC
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   20822 GenBank   NZ_OQ821059
Plasmid name   p11A1213097B_A_KPC Incompatibility group   IncFIA
Plasmid size   90910 bp Coordinate of oriT [Strand]   34400..34494 [+]
Host baterium   Enterobacter cloacae subsp. cloacae strain 11A1213CRGN097B

Cargo genes


Drug resistance gene   blaKPC-4, blaTEM-1A, aph(3')-Ia, mph(A), sul1, qacE, aac(3)-Ib, aac(6')-Ib-cr, blaOXA-1, catB3, ARR-3
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -